Nguyên Tắc Real Time Pcr

--- Bài mới hơn ---

  • Kiểm Nghiệm Salmonella Bằng Phương Pháp Real
  • Xét Nghiệm Phát Hiện Bệnh Lậu Bằng Phương Pháp Pcr
  • Các Quy Trình Xét Nghiệm Chẩn Đoán
  • Máy Pcr Là Gì? Các Loại Máy Pcr Trong Chăn Nuôi
  • Kỹ Thuật Pcr Là Gì? Ứng Dụng Trong Chẩn Đoán Bệnh Trên Tôm Thế Nào?
  • Trước khi hiểu nguyên tắc real time PCR ta cần hiểu PCR là gì

    PCR (Polemerase Chain Reaction) là gì

    Là phản ứng khuếch đại gen (tạo nhiều bản sao) hay phản ứng chuỗi trùng hợp. Là kỹ thuật sinh học phân tử nhằm khuếch đại một đoạn DNA mà không dùng sinh vật sống. PCR dùng nghiên cứu sinh học, y học phát hiện các bệnh di truyền, nhận dạng, chẩn đoán nhiễm trùng, tách dòng gen, và xác định huyết thống.

    Phương pháp căn bản chạy PCR được Kary Mullis phát minh. Ông đoạt giải Nobel về Hóa học năm 1993 chỉ sau 7 năm khi đưa ra ý tưởng. Đó là cách DNA nhân lên nhiều lần qua nhiều chu kỳ sao chép bởi enzyme DNA polymerase.

    DNA polymerase có trong sinh vật sống để thực hiện chức năng nhân DNA khi tế bào phân chia. Nó làm việc bằng cách nối với sợi DNA và tạo sợi bổ sung. Theo quy trình PCR gốc Mullis, enzyme phản ứng nhân bản DNA được thực hiện trong ống nghiệm (in vitro). Sợi DNA đôi bị tách thành 2 sợi đơn khi đun nóng ở 96 °C. Khi DNA polymerase bị phá hủy phải bổ sung enzyme sau mỗi giai đoạn nung nóng. Quy trình PCR gốc của Mullis không có hiệu quả cao vì nó mất nhiều thời gian. Nó cần một lượng lớn DNA polymerase, và phải liên tục lưu ý suốt trong quá trình PCR.

    Sau đó, quy trình gốc này được phát triển bằng cách dùng DNA-Polymerase lấy từ vi khuẩn thermophilic (ưa nhiệt). DNA polymerase từ sinh vật này là thermostable (ổn định ở nhiệt độ cao). Vì thế khi dùng trong PCR nó không bị phá vỡ khi hỗn hợp nung nóng để tách sợi DNA. Từ đó, không cần phải thêm DNA-polymerase vào mỗi chu kỳ, quá trình sao chép DNA có thể đơn giản và tự động hơn.

    Một trong những DNA-polymerase chịu nhiệt đầu tiên được phân lập được từ Thermus aquaticus và được gọi là Taq. Taq polymerase được dùng rộng rãi trong thực nghiệm PCR (5/2004). Nhược điểm của Taq là thỉnh thoảng nó nhầm lẫn trong quá trình sao chép DNA.

    Dẫn đến đột biến (sai) trong chuỗi DNA, vì nó thiếu tính sửa sai exonuclease 3′-5′. Các polymerase như Pwo hay Pfu được phân lập từ Archaea. Có cơ chế sửa sai, làm giảm một cách đáng kể số đột biến xảy ra trong chuỗi DNA được sao chép. Sự kết hợp giữa Taq và Pfu cung cấp cả độ tin cậy cao lẫn sự nhân bản chính xác của DNA.

    Nguyên tắc Real time PCR là gì

    Real-time PCR là kỹ thuật PCR mà kết quả khuếch đại DNA đích hiển thị được ngay

    sau mỗi chu kỳ nhiệt của phản ứng. Chính vì vậy nên được gọi là real-time.

    Real-time PCR khác PCR là không cần thiết phải làm tiếp các thí nghiệm để đọc và phân tích kết quả. Điều này để xác định có sản phẩm khuếch đại đích hay không. Vì kết quả cuối cùng của phản ứng khuếch đại cũng được hiển thị ngay sau khi hoàn tất phản ứng.

    Có thể nói real-time PCR là kỹ thuật nhân bản DNA đích trong ống nghiệm thành hàng tỷ bản sao dựa vào các chu kỳ nhiệt. Và kết quả khuếch đại trong ống phản ứng được hiển thị cùng lúc với phản ứng khuếch đại xảy ra để người làm thí nghiệm có thể thấy được.

    realtimePCR_basic-đã mở khóa

    --- Bài cũ hơn ---

  • Phương Pháp Real Time Pcr Với Kit Iiq
  • Xét Nghiệm Pcr Trong Chẩn Đoán Y Khoa
  • Những Điều Bạn Cần Biết Về Xét Nghiệm Pcr Hiv Hiện Nay!
  • Công Ty Hùng Phát Tặng Tỉnh Lâm Đồng Máy Xét Nghiệm Covid
  • : Điều Trị Viêm Âm Đạo Hết Bao Nhiêu Tiền?
  • Phương Pháp Real Time Pcr Với Kit Iiq

    --- Bài mới hơn ---

  • Nguyên Tắc Real Time Pcr
  • Kiểm Nghiệm Salmonella Bằng Phương Pháp Real
  • Xét Nghiệm Phát Hiện Bệnh Lậu Bằng Phương Pháp Pcr
  • Các Quy Trình Xét Nghiệm Chẩn Đoán
  • Máy Pcr Là Gì? Các Loại Máy Pcr Trong Chăn Nuôi
  • Trong bài viết này, HappyVet sẽ hướng dẫn phương pháp Real Time PCR với kit iiQ-POCKIT cho bạn đọc ứng dụng một cách chính xác nhất.

    – Heo: Mẫu máu hoặc mẫu mô tùy vào từng bệnh và sự phân bố của virus trong từng cơ quan.

    – Gà: Swab khí quản hoặc mẫu mô.

    – Đối với tất cả các mẫu: nếu sử dụng trong ngày bảo quản ở tủ lạnh 4 oC, nếu để qua đêm hoặc thời gian dài thì bảo quản ở tủ -20 o C

    – Mẫu máu bảo quản trong ống chống đông EDTA

    – Đối với DNA sau khi tách chiết xong phải sử dụng luôn nếu không phải bảo quản ngay trong tủ lạnh 4 o C.

    – Đối với đối chứng dương P+ của kit: bảo quản ở tủ lạnh 4 o C, nếu sử dụng ngay sau khi hoàn nguyên để 5 phút để chất phân rã.

    – DNA nếu lưu lại mẫu và sử dụng cho lần sau cần bảo quản tủ -20 oC (6 tháng), ARN phải bảo quản -80 oC (6 tháng) trường hợp không có tủ -80 oC thì bảo quản ở tủ -20 o C (1 tháng)

    – Hút máu tĩnh mạch trên heo và bảo quản trong ống chống đông

    – Gà: Lấy que lấy mẫu dịch swab khí quản của gà và cho vào ống eppendorf 1,5ml chứa 500ml PBS. Mổ khám lấy mẫu mô, nơi mầm bệnh khu trú nhiều nhất (tùy vào từng bệnh)

    Kit iiQ-POCKIT:

    – 1 bộ kit gồm 48 test, dạng đông khô, để bảo quản và vận chuyển dễ dàng tránh bị biến tính

    – Chuẩn bị: hoàn nguyên Kit bằng dung dịch buffer pmix đã có sẵn.

    Hút 50µl dung dịch buffer pmix cho vào kit, votex nhẹ rồi ly tâm (votex: trong vòng 5-8s, nhẹ chậm và tránh bọt khí)

    Chuẩn bị ống PCR trong phòng master mix

    Chuẩn bị Kit vào trong ống PCR: hút 23µl dung dịch kit + 2µl DNA đã tách chiết.

    Pha chuẩn dương: mỗi bộ kit có một chuẩn dương, hệ số 104, pha loãng 10 lần, lấy 27µl dung dịch tARN + 3µl chuẩn dương.

    Mỗi bộ Kit chỉ cần làm đường chuẩn 1 lần.

    FAM và VIC cho kit iiQ-POCKIT cho quá trình chạy PCR

    FAM là kết quả chạy chẩn đoán của mẫu, VIC là kết quả chạy đối chứng nội chuẩn

    Hiệu quả phản ứng: 95% ~ 105%

    Y là số ct or cq (số chu kỳ phản ứng bắt đầu), a là b là

    --- Bài cũ hơn ---

  • Xét Nghiệm Pcr Trong Chẩn Đoán Y Khoa
  • Những Điều Bạn Cần Biết Về Xét Nghiệm Pcr Hiv Hiện Nay!
  • Công Ty Hùng Phát Tặng Tỉnh Lâm Đồng Máy Xét Nghiệm Covid
  • : Điều Trị Viêm Âm Đạo Hết Bao Nhiêu Tiền?
  • Chi Phí Chữa Trị Bệnh Đau Bụng Kinh Ở Biên Hòa Giá Bao Nhiêu?
  • Sự Khác Biệt Giữa Pcr Sao Chép Ngược Và Pcr Thời Gian Thực Là Gì? Họ Có Giống Nhau Không?

    --- Bài mới hơn ---

  • Sự Khác Biệt Giữa Thời Tiết Và Khí Hậu Là Gì?
  • Phân Biệt Giữa Kiểm Tra Và Thanh Tra Thuế
  • Mối Quan Hệ Và Sự Khác Biệt Giữa Hoạt Động Thanh Tra Và Kiểm Tra, Giám Sát
  • Phân Biệt Giữa Thanh Tra Và Kiểm Tra Trong Hoạt Động Quản Lý Nhà Nước
  • Mối Quan Hệ Giữa Triết Học Và Khoa Học
  • Sự khác biệt giữa PCR sao chép ngược và PCR thời gian thực là gì? Họ có giống nhau không?

    Họ rất nhiều không giống nhau. Nhưng tôi hiểu câu hỏi đến từ đâu: cả hai có thể được viết tắt là RT- PCR. Reverse transcriptase xuất hiện đầu tiên, sau đó Real-Time đã đánh cắp từ viết tắt.

    PCR phiên mã ngược (RT-PCR):

    Mẫu: RNA.

    Enzyme: Phiên mã ngược.

    Sản phẩm cuối: dimer DNA-RNA.

    Được sử dụng để tạo mẫu DNA từ RNA cho phản ứng PCR tiếp theo. Sẽ không khuếch đại mẫu, chỉ để chuẩn bị mẫu DNA để khuếch đại. Sẽ được theo sau bởi phản ứng khuếch đại PCR (có thể bằng PCR thời gian thực hoặc thông thường).

    PCR thời gian thực (RT-PCR):

    Bản mẫu: DNA

    Enzyme: DNA polymerase

    Sản phẩm cuối: DNA

    Mục đích: đo lường sự khuếch đại của DNA trong quá trình. Là một phần của thẻ huỳnh quang hỗn hợp phản ứng được thêm vào. Tín hiệu huỳnh quang phát ra khi được kết hợp trong chuỗi xoắn DNA sợi đôi như một sản phẩm PCR. Sau mỗi chu kỳ PCR, huỳnh quang được kiểm tra và so sánh với phản ứng kiểm soát dương tính. Do đó, số lượng DNA có thể được đo sau mỗi chu kỳ (theo thời gian thực). Phản ứng PCR thông thường không cho phép – bạn đo lượng DNA sau khi kết thúc phản ứng.

    Real-Time PCR là một công cụ rất hữu ích khi bạn muốn đo lường hiệu quả của phản ứng PCR. Hiệu quả giảm sau khi đạt được nồng độ nhất định và các chu kỳ sau không đạt được hiệu quả. Ngoài ra, điện di gel agarose sau đó có thể không cần thiết với PCR thời gian thực.

    Quá trình có thể có nhược điểm, mặc dù:

      Nó đắt hơn nhiều. Nó đòi hỏi phải có trang bị chuyên dụng. Sản phẩm này có thể không phù hợp với các ứng dụng tiếp theo như nhân bản.

    Nhưng này, bạn nhận được một câu trả lời định lượng ngay lập tức!

    Điều đầu tiên, bộ não sẽ dễ dàng phân biệt hơn nếu chúng ta đề cập đến transcriptase-PCR ngược là rtPCR và gọi PCR thời gian thực là PCR định lượng (qPCR).

    rtPCR về cơ bản bắt đầu bằng cách tạo DNA bổ sung (cDNA) từ mRNA. Để làm điều này, enzyme phiên mã ngược được yêu cầu. Phiên mã ngược tương tự như DNA polymerase, chỉ có nó đọc RNA để sắp xếp chuỗi bổ sung DNA chuỗi đơn. RNase H là một endonuclease phải được thêm vào để loại bỏ RNA khỏi chuỗi cDNA. Từ thời điểm này, DNA polymerase 1 được thêm vào, và PCR bình thường xảy ra để tạo ra một chuỗi DNA khác bổ sung cho cDNA.

    qPCR, đối với hầu hết các phần, giống như PCR và rtPCR thông thường. Sự khác biệt là qPCR sử dụng các phương pháp định lượng như ghi nhãn huỳnh quang để theo dõi quá trình sản xuất DNA trong thời gian thực của Hồi, tên vì thế. rt-qPCR là một quá trình trong đó DNA được tổng hợp từ mRNA, nhưng thuốc nhuộm huỳnh quang hoặc đầu dò được thêm vào cho mỗi chu kỳ tổng hợp DNA. Ý tưởng chung là sự phát triển mạnh mẽ khi nhiều DNA được tổng hợp.

    Điều thú vị về việc tạo cDNA từ mRNA là DNA đủ ổn định để được nối vào một vec tơ tiêu hóa, sau đó có thể được chuyển thành tế bào chủ. Sau đó, tế bào chủ có thể biểu thị sản phẩm của gen mục tiêu.

    Điều đầu tiên, bộ não sẽ dễ dàng phân biệt hơn nếu chúng ta đề cập đến transcriptase-PCR ngược là rtPCR và gọi PCR thời gian thực là PCR định lượng (qPCR).

    rtPCR về cơ bản bắt đầu bằng cách tạo DNA bổ sung (cDNA) từ mRNA. Để làm điều này, enzyme phiên mã ngược được yêu cầu. Phiên mã ngược tương tự như DNA polymerase, chỉ có nó đọc RNA để sắp xếp chuỗi bổ sung DNA chuỗi đơn. RNase H là một endonuclease phải được thêm vào để loại bỏ RNA khỏi chuỗi cDNA. Từ thời điểm này, DNA polymerase 1 được thêm vào, và PCR bình thường xảy ra để tạo ra một chuỗi DNA khác bổ sung cho cDNA.

    qPCR, đối với hầu hết các phần, giống như PCR và rtPCR thông thường. Sự khác biệt là qPCR sử dụng các phương pháp định lượng như ghi nhãn huỳnh quang để theo dõi quá trình sản xuất DNA trong thời gian thực của Hồi, tên vì thế. rt-qPCR là một quá trình trong đó DNA được tổng hợp từ mRNA, nhưng thuốc nhuộm huỳnh quang hoặc đầu dò được thêm vào cho mỗi chu kỳ tổng hợp DNA. Ý tưởng chung là sự phát triển mạnh mẽ khi nhiều DNA được tổng hợp.

    Điều thú vị về việc tạo cDNA từ mRNA là DNA đủ ổn định để được nối vào một vec tơ tiêu hóa, sau đó có thể được chuyển thành tế bào chủ. Sau đó, tế bào chủ có thể biểu thị sản phẩm của gen mục tiêu. © 2022

    --- Bài cũ hơn ---

  • Sự Khác Biệt Giữa Nhu Cầu Và Mong Muốn
  • Sự Khác Biệt Giữa Nhu Cầu Và Muốn
  • Sự Khác Nhau Giữa Cưa Gỗ Và Cưa Kim Loại
  • Fob Là Gì? So Sánh Fob Với Các Hình Thức Vận Tải Cir, Cfr, Fas
  • Sự Khác Biệt Giữa Máy Lạnh Và Máy Điều Hòa
  • Hô Biến Pcr Thành Real

    --- Bài mới hơn ---

  • Sự Khác Nhau Giữa Công Chức Và Viên Chức?
  • Cấu While, Meanwhile, Meantime: Công Thức, Sự Khác Biệt Và Bài Tập
  • Phân Biệt During Và Through
  • Cách Dùng Và Phân Biệt “During” Và “Through”
  • Phân Biệt Otherwise Và Unless Trong Tiếng Anh
  • Trong bài viết hôm nay, tôi sẽ mổ xẻ từ “ĐƯỢC” trên, nghĩa là những yếu tố bạn cần có để chuyển đổi nhanh chóng một phản ứng PCR thông thường thành Real-time PCR trong vòng…7 nốt nhạc! 🙂 

    Cách sử dụng EvaGreen cũng khá đơn giản. Ống EvaGreen bạn mua về thường có nồng độ cao, 100X. Bạn chỉ việc hút 1 lượng thể tích nhỏ bổ sung vào phản ứng PCR của mình sao cho nồng độ cuối của EvaGreen vào khoảng 0.5X – 1X là được. Ví dụ, nếu tổng thể tích phản ứng PCR của bạn (tính luôn lượng DNA cho vào) là 25 μl, bạn chỉ cần hút 0,25 μl EvaGreen 100X cho vào ống phản ứng để được nồng độ cuối là 1X.

    Vậy thì, tại sao bạn phải chạy thêm bước phân tích Melting Curve này? Câu trả lời là: “Để biết tín hiệu huỳnh quang tạo ra từ phản ứng là do sản phẩm PCR đặc hiệu chứ không phải do primer dimer gây ra”.

    Theo nguyên tắc, EvaGreen sẽ bám vào bất kỳ phân tử DNA mạch đôi nào có mặt trong phản ứng và phát ra huỳnh quang. Thế nên, cho dù phản ứng của bạn không hề có sản phẩm PCR đặc hiệu mà chỉ cho các primer dimer thì bạn vẫn sẽ thu được đường biểu diễn tín hiệu huỳnh quang tăng vọt vào những chu kỳ 35-40, và dẫn đến kết luận DƯƠNG TÍNH GIẢ! Để tránh trường hợp này xảy ra, bạn phải dựa trên kết quả phân tích Tm của tất cả các sản phẩm DNA mạch đôi có trong phản ứng. Tm của primer dimer thường rất thấp, khoảng 60-70oC, rất dễ phân biệt với Tm của sản phẩm PCR đặc hiệu, dao động trong khoảng 75-90oC.

    Thứ tư, phải sử dụng tube 0,2 ml phù hợp với máy Real-time PCR. Vì đại đa số các máy Real-time PCR hiện có trên thị trường Việt Nam thường ghi nhận tín hiệu huỳnh quang xuyên qua nắp tube chứa phản ứng, nên bạn phải chắc chắn sử dụng đúng loại tube 0,2ml có nắp trong suốt (optical cap) chuyên dụng cho Real-time PCR.

    Cuối cùng, ngoài lề một chút, tôi xin chia sẻ rằng với Real-time PCR sử dụng EvaGreen hay SYBR Green, bạn có thể nhân bản và phát hiện dễ dàng những đoạn gene rất ngắn, khoảng chừng 70-80 bp, điều rất khó thực hiện khi sử dụng PCR-Điện di thông thường (vì khó quan sát trên gel agarose). Tôi từng nhân bản và sử dụng phân tích Melting Curve để phát hiện thành công những đoạn DNA rất nhỏ này từ gene interleukin 28B của người trong đề tài nghiên cứu sinh của mình. Bạn chỉ cần có một chút kiến thức về sinh học phân tử để chọn được những vùng gene có Tm cao dùng cho thiết kế primer thì mọi chuyện sẽ trở nên rất dễ dàng.





     7,900 total views,  9 views today

    --- Bài cũ hơn ---

  • Phân Biệt Các Kĩ Thuật Xét Nghiệm Pcr: Rt
  • Về Các Tội Xâm Phạm Tính Mạng, Sức Khỏe, Nhân Phẩm, Danh Dự Của Con Người (Phần I)
  • Câu Hỏi Thường Gặp Trong Ngoại Thương (Chuẩn Nhất)
  • Các Từ Tiếng Anh Dễ Gây Nhầm Lẫn Khi Sử Dụng
  • Sự Khác Biệt Giữu Forex Và Chứng Khoán
  • Khái Quát Về Kỹ Thuật Real Time Pcr Là Gì? Ứng Dụng Chẩn Đoán Bệnh Tôm

    --- Bài mới hơn ---

  • Pcr Là Gì? Nguyên Tắc, Qúa Trình & Ứng Dụng Của Máy Chu Kỳ Nhiệt
  • Pcr Nguyên Tắc Và Ứng Dụng
  • Việt Nam Bổ Sung Phương Pháp Xét Nghiệm Ncov Mới
  • Xử Lý Nước Thải Bằng Phương Pháp Oxi Hóa
  • Một Số Phương Pháp Cân Bằng Phản Ứng Oxi Hóa Khử
  • 1. Giới thiệu kỹ thuật Real time PCR là gì?

    Realtime PCR là một kỹ thuật sinh học phân tử được sử dụng trong phòng thí nghiệm dựa trên phản ứng tổng hợp chuỗi (Polymerase chain reaction – PCR), nhằm khuếch đại và cùng lúc xác định được số lượng của phân tử DNA mong muốn. Áp dụng kỹ thuật Realtime PCR người dùng không cần thiết phải thực hiện thao tác điện di sản phẩm PCR trên gel agarose để xác định sản phẩm sau khuếch đại.

    Giải đáp xét nghiệm Real time PCR là gì?

    Kỹ thuật Real time PCR gồm hai quá trình diễn ra đồng thời: nhân bản DNA bằng phản ứng PCR và đo độ phát huỳnh quang tỷ lệ thuận hoặc nghịch với số đoạn DNA tạo thành.

    Thành phần máy Realtime PCR bao gồm:

    – Phần luân nhiệt

    – Phần quang học

    – Phần mềm theo dõi và phân tích kết quả.

    Trình tự thực hiện kỹ thuật Realtime PCR được thực hiên trong một máy luân nhiệt như sau:

    – Các mẫu ADN được gắn với mồi có chất phát huỳnh quang.

    – Các mẫu ADN này sẽ được khuếch đại thông qua phản ứng PCR.

    – Máy Realtime PCR sẽ chiếu một chùm sáng kích thích có bước sóng nhất định vào các tube chứa mẫu ADN này.

    – Các mẫu ADN gắn mồi huỳnh quang sau khi bị kích thích, sẽ phát ra chùm sáng phát xạ.

    – Bộ thu dữ liệu (detector) bên trong máy luân nhiệt sẽ thu nhận và xác định bước sóng của ánh sáng huỳnh quang phát ra từ các phân tử huỳnh quang bị kích hoạt trong mẫu.

    – Phần mềm sẽ phân tích và cho kết quả trên màn hình hiển thị

    2. Ứng dụng kỹ thuật Realtime PCR trong chẩn đoán bệnh tôm

    Sau khi nắm được định nghĩa kỹ thuật Real time PCR là gì chắc hẳn nhiều người nuôi tôm muốn biết đến ứng dụng kỹ thuật Real time PCR trong chẩn đoán bệnh tôm.

    Hiện nay, kỹ thuật Realtime PCR được ứng dụng trong nhiều lĩnh vực như thủy sản, thú y, sinh dược, thực phẩm, nghiên cứu,… Riêng trong lĩnh vực thủy sản, đặc biệt là ngành nuôi tôm công nghiệp đang phải đối mặt với nhiều rủi ro, trong đó, dịch bệnh nguy hiểm trên tôm như bệnh đốm trắng trên tôm, EMS, EHP, IMNV, YHV… đã gây ra thiệt hại kinh tế rất nghiêm trọng. Trước thực trạng trên, kỹ thuật Realtime PCR được đánh giá là công cụ hữu hiệu và được sử dụng phổ biến giúp chẩn đoán sớm và phòng ngừa sự lây lan dịch bệnh. Đồng thời, kỹ thuật Realtime PCR còn giúp kiểm soát tốt mầm bệnh nguồn giống đầu vào và các mặt hàng tôm xuất khẩu theo yêu cầu của các nước nhập khẩu như Úc, Hàn Quốc, EU, Mỹ…

    Xét nghiệm Realtime PCR chẩn đoán bệnh tôm chính xác

    Việc chẩn đoán bệnh tôm dựa trên kỹ thuật Realtime PCR cần phải có bộ Kit (bộ hóa chất phản ứng) được thiết kế phù hợp với từng đối tượng bệnh. Với nhiều năm kinh nghiệm trên thị trường, GeneReach đã phát triển bộ Kit IQ REAL như một hệ thống chẩn đoán bệnh dựa trên kỹ thuật Realtime PCR cho phép phát hiện sớm, chính xác, nhạy, và đặc hiệu với tác nhân gây bệnh.

    Hiện nay, kit IQ REAL được phát triển để phát hiện sớm các bệnh trên tôm như:

    – Bệnh đốm trắng trên tôm (WSSV)

    – Bệnh hoại tử gan tụy cấp trên tôm (AHPND/EMS)

    – Bệnh vi bào tử trùng trên tôm (EHP)

    – Bệnh hoại tử cơ trên tôm (IMNV)

    – Bệnh còi do virus Monodon baculovirus (MBV)

    – Bệnh hoại tử dưới vỏ và cơ quan tạo máu (IHHNV)

    – Hội chứng Taura trên tôm (TSV)

    – Bệnh đầu vàng trên tôm (YHV)

    – Bệnh do vi khuẩn gây hoại tử gan tụy (NHPB).

    KIT IQ Real được sử dụng trong kỹ thuật Realtime PCR

    Kit IQ REAL được sử dụng cho phòng thí nghiệm Real-time PCR. Ngoài ra, kỹ thuật Real time còn được ứng dụng nhiều trong lĩnh vực vi sinh vật học, trong nghiên cứu, xác định tác nhân gây bệnh ở thực vật, Xác định các sinh vật biến đổi gen, định lượng lâm sàng và kiểm tra kiểu gen, …

    Hiện tại các bộ Kit IQ REAL đã được chúng tôi nhập khẩu chính hãng từ IQ REAL với mong muốn đem đến cho người nuôi trồng thủy sản bộ sản phẩm ứng dụng kỹ thuật Real time PCR một các tốt nhất trên thị trường. Liên hệ ngay 19002620 để được tư vấn và báo giá chi tiết về sản phẩm.

    --- Bài cũ hơn ---

  • Máy Pcr Là Gì? Công Dụng Của Máy Pcr Pockit Cầm Tay
  • Các Kỹ Thuật Pcr Và Ứng Dụng
  • Tìm Hiểu Về Dịch Vụ Xét Nghiệm Xác Định Đột Biến Gen Bằng Kỹ Thuật Pcr
  • Tư Vấn Xét Nghiệm Hiv Bằng Phương Pháp Pcr
  • Tìm Hiểu Phương Pháp Xét Nghiệm Pcr Hiv Hiện Nay
  • Giới Thiệu Về Pcr Và Kỹ Thuật Realtime Pcr

    --- Bài mới hơn ---

  • Cty Tnhh Khoa Học Hợp Nhất
  • Phân Biệt Giữa Kiểm Tra Và Thanh Tra Thuế 2022
  • Hoạt Động Thanh Tra Gd, Kiểm Tra Nội Bộ Trường Học, Ttrnd
  • Từ Vựng Về Thời Gian ” Học Ielts
  • So Sánh Từ A Đến Z: “sự Khác Nhau Giữa Bếp Từ Âm Và Bếp Từ Dương”
  • – Kỹ thuật PCR: là kỹ thuật sinh học phân tử (SHPT) cho phép nhân bản một đoạn DNA mong muốn từ hệ gen DNA của cơ thể sinh vật thành nhiều bản sao. Kết quả chu kì cuối được phân tích bằng điện di.

    Các sản phẩm của quá trình chạy PCR được gắn với huỳnh quang và dựa vào ngưỡng phát hiện huỳnh quang (sớm hay muộn) mà người làm thí nghiệm sẽ biết được số lượng DNA đích ban đầu có trong ống phản ứng.

    Sau PCR, sử dụng điện di trên gel agarose/ thực hiện thí nghiệm lai với đoạn dò đặc hiệu để xác định sản phẩm khuyếch đại.

    Biểu đồ 1: Biểu đồ khuếch đại

    Biểu đồ 1: Biểu đồ một đường biểu diễn khuếch đại ghi nhận cường độ huỳnh quang phát ra từ ống phản ứng khi nhận được ánh sánh kích thích vào mỗi chu kỳ nhiệt

    -Trục tung: biểu diễn cường độ huỳnh quang phát ra từ ống phản ứng khi nhận ánh sáng kích thích.

    – Trục hoành: biểu diễn số chu kỳ nhiệt.

    – Đường nền (baseline): được định nghĩa là số chu kỳ PCR trong đó tín hiệu huỳnh quang đặc hiệu tích lũy dần nhưng chưa đạt ngưỡng nhận biết của thiết bị. Theo mặc định, đường nền được xác lập trong khoảng chu kỳ 3 đến 15 và có thể được thay đổi.

    – Cường độ huỳnh quang nền: TB cộng của cường độ huỳnh quang xuất hiện trong ống phản ứng trong 1 số chu kỳ đầu.

    – Chu kỳ ngưỡng (Ct): là chu kỳ nhiệt mà ở tại thời điểm đó, thiết bị Realtime ghi nhận được tín hiệu huỳnh quang phát ra từ ống phản ứng bắt đầu vượt qua cường độ huỳnh quang nền.

    Để real-time PCR xác định được chính xác số lượng bản đích ban đầu có trong mẫu thử, phải thực hiện real-time PCR các mẫu thử chứa các số lượng bản DNA đích ban đầu cần xác định số lượng cùng lúc với các mẫu chuẩn chứa số lượng DNA đích ban đầu đã biết rõ số lượng

    Biểu đồ đường biểu diễn chuẩn – Standard curve

    Đường biểu diễn vẽ lên mối quan hệ giữa chu kỳ ngưỡng với số lượng bản DNA đích ban đầu có trong các mẫu chuẩn được gọi là đường biểu diễn chuẩn.

    Các loại hóa chất:

    3.1. Chất phát huỳnh quang là một loại màu huỳnh quang chèn vào sợi đôi DNA(SYBR)

    Cơ chế hoạt động:

    – Khi chưa có sản phẩm khuyếch đại thì ống nghiệm không phát được huỳnh quang khi nhận ánh sáng kích thích.

    – Nhưng khi có sản phẩm khuyếch đại thì SYBR 1 chèn vào và tập trung trên phân tử DNA làm cho ống phản ứng phát quang khi nhận ánh sáng kích thích.

    SYBR Green I:

    -Tính đặc hiệu không cao

    – Tầm soát sản phẩm trước khi sử dụng probe đặc hiệu

    – Thực hiện khi PCR đã được tối ưu hóa, không có primer dimer

    Để khắc phục nhược điểm của SYBR I, sử dụng Melting Curve có thể phân biệt được sản phẩm khuyếch đại từ DNA đích hay từ dimer primer dựa vào nhiệt độ chảy

    3.2.2 Beacon Probe

    Cách đọc kết quả realtime-PCR

    Kết quả định tính:

    Mẫu dương tính:

    Mẫu xét nghiệm

    Mẫu chứng dương

    Kết quả định lượng:

    Mẫu dương tính dưới ngưỡng phát hiện

    Mẫu dương tính: 1.25 x 105 copies/ml

    – Kỹ thuật PCR định lượng được ứng dụng rộng rãi trong nghiên cứu, chẩn đoán và đánh giá hiệu quả của điều trị.

    – Đánh giá sự biểu hiện của các gen trong tế bào ở mức độ RNA.

    – Phát hiện và định lượng các tác nhân gây bệnh như vi khuẩn, virus và nấm phục vụ cho việc chẩn đoán và điều trị.

    – Xác định đột biến gen với các cặp mồi đặc hiệu cho từng đột biến.

    – Xác định các đa hình thái đơn (SNPs) với các cặp mồi đặc hiệu.

    --- Bài cũ hơn ---

  • Sự Khác Biệt Giữa Nhu Cầu Và Mong Muốn Là Gì?
  • Sự Khác Biệt Giữa Màn Hình Tương Tác Và Bảng Tương Tác
  • Sự Khác Biệt Giữa Căn Hộ Dịch Vụ, Căn Hộ Và Căn Hộ Máy Lạnh
  • Sơ Lược Về Can Và Could
  • Cửa Gỗ Hàn Quốc Hdf Laminate Và Hdf Melamine Có Gì Khác Nhau
  • Sự Khác Nhau Giữa How Long Và How Many Times

    --- Bài mới hơn ---

  • Sự Khác Biệt Giữa Cấp Phép Và Nhượng Quyền Thương Mại
  • Cách Phân Biệt Máu Báo Thai, Máu Kinh Nguyệt Và Máu Báo Sảy Thai 2022
  • Liệu Triết Học Có Phải Là Khoa Học Không? :: Suy Ngẫm & Tự Vấn :: Chú
  • Sự Khác Biệt Giữa Khoa Học Và Triết Học Là Gì?
  • Sự Khác Biệt Giữa Khoa Học Và Triết Học
    • How long…? được dùng để đặt câu hỏi về khoảng thời gian – bao lâu. Hãy xem các ví dụ sau:

    ‘How long have you been waiting?’ ‘Only for a minute or two.’ ‘How long have they been married?’ ‘Oh, for a very long time. More than 25 years.’ ‘How long will the concert last?’ ‘It should be over by ten o’ clock, I think.’ ‘How long was your stay in Malaysia?’ ‘The project lasted for two years, but I was there for two and a half years.’ ‘How long have you been living in this house?’ ‘For 12 years now, ever since my mother died.’ ‘How much longer can you stay?’ ‘Not much longer. For another ten minutes perhaps. I have to be home before midnight.’

    Xin lưu ý cấu trúc này thường được dùng với giới từ ” for” hoặc ” since ” trong câu trả lời.

    ‘How long was the wedding dress?’ ‘It was very short, knee-length really.’ ‘I see you are growing your hair. How long do you want it to be?’ ‘Shoulder-length at least.’

      Nếu bạn dùng cấu trúc câu How many times…?, bạn hỏi về con số cụ thể mỗi lần một việc gì xảy ra. Hãy xem các ví dụ sau:

    How many times have you read that book?’ ‘At least ten times. I really like it.’

    ‘How many times did you visit them last summer?’ ‘Almost every weekend.’ ‘How many times did the phone ring last night?’ ‘We must have had about twenty calls.’

    ‘How many times have I told you not to play football in the garden?

      Xin lưu ý cấu trúc How often…? thường được dùng thường xuyên hơn cấu trúc How many times...?

    Khi bạn dùng cấu trúc này bạn hỏi một việc gì đó xảy ra thường xuyên như thế nào.

    Không giống How many times…? vốn thường được dùng để nói tới những dịp trong quá khứ, How often …? được dùng để nói tới các tình huống trong quá khứ, hiện tại và tương lai. Hãy xem các ví dụ sau:

    ‘How often do you plan to play tennis this summer?’ ‘As often as possible. Every day, if I can.’ ‘How often will you visit your mother in hospital?’ ‘I shall try to visit at least once a week.’ ‘How often did you go to the cinema when you were young?’ ‘Every weekend, without fail. There was no television then.’ ‘How often do you go to the big supermarket to do your shopping?’ ‘Not very often. Perhaps once a month.’ ‘When you lived in London, how often did you go to the theatre?’ ‘We used to go three or four times a year – something like that.’

    --- Bài cũ hơn ---

  • Sự Khác Nhau Giữa Bring, Carry, Take Và Fetch
  • Áo Vest Là Gì? Những Kiến Thức Về Áo Vest Từ A
  • #đánh Giá Áo Khoác Blazer Là Gì? Cách Mix Đồ Với Áo Blazer ™️ Pedro Việt Nam
  • Sự Khác Nhau Giữa Áo Vest Và Comple 2022
  • Bí Mật Về Chiếc Áo Khoác Blazer Của Bạn
  • Máy Pcr Là Gì? Công Dụng Của Máy Pcr Pockit Cầm Tay

    --- Bài mới hơn ---

  • Khái Quát Về Kỹ Thuật Real Time Pcr Là Gì? Ứng Dụng Chẩn Đoán Bệnh Tôm
  • Pcr Là Gì? Nguyên Tắc, Qúa Trình & Ứng Dụng Của Máy Chu Kỳ Nhiệt
  • Pcr Nguyên Tắc Và Ứng Dụng
  • Việt Nam Bổ Sung Phương Pháp Xét Nghiệm Ncov Mới
  • Xử Lý Nước Thải Bằng Phương Pháp Oxi Hóa
  • Những năm gần đây, với việc ứng dụng máy PCR trong chẩn đoán bệnh tôm đã giúp người nuôi sàng lọc và ngăn ngừa dịch bệnh lây lan từ đó giảm thiệt hại đáng kể, đem lại năng suất cao cho vụ nuôi. Nhưng nhiều người khi mới bước chân vào nghề vẫn còn băn khoăn chưa biết máy PCR là gì? Công dụng máy PCR ra sao? Nên mua máy PCR ở đâu uy tín hiện nay? Câu trả lời sẽ được chúng tôi giải đáp trong bài viết này.

    Ngành nuôi tôm công nghiệp đang phát triển nhanh chóng, thu hút nhiều doanh nghiệp đầu tư và đem lại nguồn ngoại tệ lớn cho đất nước. Các mô hình nuôi tôm thâm canh mật độ cao ngày càng được mở rộng kéo theo đó là những thách thức về dịch bệnh, biến đổi khí hậu gây thiệt hại lớn cho vụ nuôi. Bệnh hoại tử gan tụy trên tôm đã từng gây tổn thất lớn cho ngành tôm toàn cầu. Trong giai đoạn năm 2009 – 2022 dịch bệnh EMS/AHPND bùng phát mạnh mẽ đã gây thiệt hại khoảng 22,5 tỷ USD cho ngành nuôi tôm công nghiệp tại Châu Á. Với việc ứng dụng máy PCR trong xét nghiệm bệnh tôm là phương pháp hữu hiệu giúp chẩn đoán chính xác các loại bệnh có nguồn gốc từ vi khuẩn, virus gây ra, từ đó đưa ra biện pháp phòng trị hiệu quả nhất.

    Tìm hiểu máy PCR là gì?

    Máy PCR (máy luân nhiệt) là thiết bị không thể thiếu trong phòng Lab thủy sản, ứng dụng trong chẩn đoán các bệnh do vi khuẩn, virus gây bệnh trên tôm và cá. Phản ứng PCR dựa vào đặc tính DNA bị biến tính ở nhiệt độ cao và hồi tính.

    Kỹ thuật PCR được ứng dụng chẩn đoán bệnh tôm

    Trước đây, PCR truyền thống cần phải có giai đoạn phân tích sau khi khuếch đại. Nhưng hiện nay, các loại máy PCR real time cho kết quả khuếch đại AND đích được hiển thị sau mỗi chu kỳ phản ứng PCR.

    PCR real time là kỹ thuật nhân bản AND đích trong ống nghiệm thành nhiều bản sao dựa vào chu kỳ nhiệt khác nhau, kết quả khuếch đại sẽ được hiển thị cùng một lúc. Ưu điểm khi sử dụng máy PCR real time là không cần phải thực hiện thao tác điện di sản phẩm PCR trên gel agarose nhằm xác định sản phẩm sau khuếch đại.

    Nguyên lý máy PCR hoạt động như nào?

    Phản ứng PCR gồm nhiều chu kỳ nối tiếp nhau, mỗi chu kỳ sẽ lặp đi lặp lại 3 bước sau đây:

    Bước 1: Tách sợi DNA thành sợi đơn ở nhiệt độ 94 – 95 độ C

    Bước 2: Bắt cặp mồi vào sợi DNA nhiệt độ khoảng 55 – 65 độ C

    Bước 3: Kéo dài chuỗi mới ở nhiệt độ 72 độ C. Bước này cần phải có sự hiện diện các deoxy nucleoside triphosphate (dNTP).

    Công dụng máy PCR trong nuôi tôm

    Nắm được máy PCR là gì rồi thì chắc hẳn người nuôi còn băn khoăn không biết công dụng máy PCR trong nuôi tôm như thế nào đúng không?

    Hiện nay, kỹ thuật PCR được sử dụng phổ biến trong lĩnh vực thủy sản, thú y, sinh dược, thực phẩm, nghiên cứu,… Trong nuôi tôm công nghiệp, máy PCR được sử dụng trong chẩn đoán, phát hiện nhanh các bệnh nguy hiểm trên tôm như: EMS, IMNV, YHV, EHP,….

    Nếu trước đây, khi cần phải xét nghiệm bệnh tôm thì người nuôi cần phải tìm đến phòng thí nghiệm thủy sản. Nhưng giờ đây, khi khoa học kỹ thuật ngày càng phát triển, con người đã cho ra đời những loại máy PCR Pockit vận hành dựa trên công nghệ iiPCR cho phép chẩn đoán nhanh bệnh tôm ngay tại ao nuôi chỉ trong 1 giờ đồng hồ.

    Máy PCR có thể chẩn đoán nhanh một số bệnh trên tôm như:

    – WSSV: Bệnh đốm trắng trên tôm

    – EHP: Bệnh vi bào tử trùng trên tôm

    – AHPND/EMS: Bệnh hoại tự gan tụy trên tôm

    – TSV: Hội chứng Taura trên tôm

    – YHV: Bệnh đầu vàng trên tôm

    – IMNV: Bệnh hoại tử cơ trên tôm

    – IHHNV: Bệnh hoại tử dưới vỏ và cơ quan tạo máu

    – NHPB: Vi khuẩn gây hoại tử trên tôm

    – …..v.v.v

    Xét nghiệm PCR phát hiện sớm Vibrio gây bệnh hoại tử gan tụy trên tôm

    Ngoài ra, kỹ thuật PCR còn được ứng dụng để nhận dạng sinh vật, phát hiện các đột biến gen, nhân dòng gen, nghiên cứu sự biểu hiện den, tạp đột biến định vị,…

    Ưu điểm của máy PCR

    – Cho kết quả chính xác và nhanh chóng

    – Đơn giản, dễ thực hiện

    – Yêu cầu về độ tinh sạch của mẫu không cần cao

    – Kỹ thuật PCR cho phép phân biệt được gen đột biến do mất đoạn, thêm đoạn, đột biến điểm

    TOP 2 loại máy PCR nên dùng hiện nay

    1. Máy PCR – Pockit Xpss

    Pockit Xpss xuất xứ GeneReach Biotechnology – Đài Loan được vận hành dựa trên kỹ thuật IIPCR hiện đại với đầu dò Taqman cho phép chẩn đoán nhanh các bệnh thường gặp tên tôm thẻ chân trắng, tôm sú. Kết quả được hiển thị trên màn hình LCD, độ nhạy với 10 copy/ phản ứng. Sản phẩm đo được 8 mẫu/ lần đo và có thể tiến hành tại ao nuôi.

    Máy Pockit Xpss có sẵn tại chúng tôi

    2. Máy PCR – Pockit Micro Plus

    Pockit Micro Plus cũng là một dòng máy xuất xứ GeneReach Biotechnology – Đài Loan nhưng thiết kế nhỏ gọn hơn so với máy Pockit Xpss. Máy được thiết kế màn hình cho phép đọc kết quả dương tính hoặc âm tính một cách chính xác. Độ nhạy 10 copy/ phản ứng, với 4 mẫu/ lần.

    Máy Pockit Micro Plus xét nghiệm bệnh ngay tại ao nuôi Bà Lê Thị Sol Pha – Công ty CP Công nghệ AquaMekong cho biết: “Việc định kỳ sử dụng máy PCR để kiểm soát bệnh trong ao nuôi tôm là tiền đề lớn cho một vụ nuôi thành công. Chính vì thế, hãng GeneReach Biotechnology – Đài Loan đã đem đến công nghệ “Bác sĩ di động” giúp người nuôi chẩn đoán, phát hiện nhanh các bệnh trên tôm để có các biện pháp phòng và trị bệnh một cách hiệu quả. Việc sử dụng máy PCR trong nuôi tôm còn đem lại lợi ích đáng kể trong việc: kiểm tra chất lượng con giống, quản lý tốt sức khỏe tôm nuôi, đồng thời sàng lọc các mối rủi ro, ngăn ngừa sự lây lan dịch bệnh.”

    Đại chỉ mua máy PCR uy tín

    Đứng trước tình hình nuôi tôm công nghiệp tại Việt Nam gặp nhiều về cản trở như dịch bệnh, biến đổi hậu,… Một trong những giải pháp khắc phục hiệu quả là áp dụng công nghệ 4.0 vào thủy sản nhằm giúp người nuôi kiểm soát dịch bệnh hiệu quả nhất. Hiểu được điều đó, chúng tôi đã hợp tác với hãng GeneReach Biotechnology – Đài Loan đem đến cho người nuôi tôm 2 loại máy Pockit Xpss, Pockit Micro Plus với mức giá hợp lý.

    Máy PCR giá bao nhiêu tại Dr.Tom?

    Hiện tại chúng tôi bán máy PCR Pockit Xpss có mức giá 130.000.000 VNĐ; Máy PCR cầm tay Pockit Micro Plus có giá 54.800.000 VNĐ. Với mức giá trên, đối với những hộ nuôi khá giả, có hệ thống ao nuôi lớn thì nên đầu tư 1 thiết bị PCR Pockit chuyên dụng. Còn đối với những hộ nuôi khó khăn hơn thì nên mua theo hình thức hợp tác xã, khoảng 3 – 4 hộ chung 1 máy Pockit Xpss hoặc Pockit Micro Plus để tiết kiệm chi phí đầu tư mà vẫn đảm bảo kiểm tra, kiểm soát được tình hình dịch bệnh trong ao nuôi tôm cách hiệu quả.


    Top 2 loại PCR Pockit đang có sẵn tại chúng tôi Liên hệ ngay số HOTLINE 1900 2620 để được tư vấn chi tiết về công dụng, cách sử dụng, báo giá máy PCR tốt nhất. Hy vọng rằng, bài viết về máy PCR là gìcông dụng máy PCR đã giúp người nuôi có thêm kiến thức để áp dụng vào kiểm soát dịch bệnh một cách hiệu quả nhất.

    --- Bài cũ hơn ---

  • Các Kỹ Thuật Pcr Và Ứng Dụng
  • Tìm Hiểu Về Dịch Vụ Xét Nghiệm Xác Định Đột Biến Gen Bằng Kỹ Thuật Pcr
  • Tư Vấn Xét Nghiệm Hiv Bằng Phương Pháp Pcr
  • Tìm Hiểu Phương Pháp Xét Nghiệm Pcr Hiv Hiện Nay
  • Tại Sao Áp Dụng Gộp Mẫu Thực Hiện Xét Nghiệm Rt
  • Máy Pcr Là Gì? Các Loại Máy Pcr Trong Chăn Nuôi

    --- Bài mới hơn ---

  • Kỹ Thuật Pcr Là Gì? Ứng Dụng Trong Chẩn Đoán Bệnh Trên Tôm Thế Nào?
  • Phương Pháp Định Tính Bằng Kỹ Thuật Polymerase Chain Reaction
  • Người Dân Hà Nội Lo Lắng, Chờ Đợi Được Xét Nghiệm Rt
  • Bài Tập Cân Bằng Phản Ứng Oxi Hóa Khử
  • Ứng Dụng Của Chuẩn Độ Oxi Hóa
  • Máy PCR từ lâu đã được sử dụng phổ biến trong các nghiên cứu sinh học, y học nhằm phát hiện các bệnh do virus, vi khuẩn, chẩn đoán những bệnh nhiễm trùng, tách dòng gene và xác định huyết thống,… Bài viết này HappyVet sẽ cùng quý bạn đọc đi tìm hiểu chi tiết về máy PCR là gì và các loại máy PCR được sử dụng phổ biến trong chăn nuôi.


    1. Máy PCR là gì?

    Máy PCR (máy luân nhiệt) là thiết bị chẩn đoán bệnh thú y không thể thiếu trong phòng lab sinh học, y tế. PCR là chữ viết tắt của cụm từ Polymerase Chain Reaction – Đây là phương pháp khuếch đại nhanh nhiều bản sao các đoạn DNA mà không qua tạo dòng. Nếu trước đây một thí nghiệm sinh học phân tử phải kéo dài hàng tuần, hàng tháng, thì ngày nay nhờ kỹ thuật PCR ra đời mà các thí nghiệm chỉ thực hiện trong vài ngày, thậm chí trong vài giờ.

    Kỹ thuật PCR được ứng dụng trong nhiều lĩnh vực như chẩn đoán, xét nghiệm các tác nhân vi sinh vật gây bệnh, xác định giới thính của phôi, giải mã di truyền, tạo giống, nghiên cứu sự tiến hóa của sinh vật ở mức độ phân tử, chẩn đoán bệnh do virus, vi khuẩn gây bệnh,…

    Nếu như kỹ thuật PCR truyền thống cần phải có giai đoạn phân tích sau khuếch đại thì hiện nay các loại máy PCR real time cho kết quả khuếch đại AND đích được hiển thị sau mỗi chu kỳ phản ứng. Ưu điểm của việc sử dụng PCR real time là không cần phải thực hiện thao tác điện di sản phẩm PCR trên gel agarose nhằm xác định sản phẩm sau khuếch đại.

    2. Nguyên lý máy PCR

    Nguyên lý hoạt động của máy PCR là việc tổng hợp DNA dựa trên mạch khuôn là một trình tự đích DNA ban đầu, khuếch đại, nhân số lượng bản sao của khuôn này thành hàng triệu bản sao thông qua hoạt động của enzyme polymerase và một cặp mồi đặc hiệu cho đoạn DNA này.

    Phản ứng PCR gồm nhiều chu kỳ và được lặp lại nối tiếp nhau, mỗi chu kỳ được diễn ra theo 3 bước:

    Bước 1: Biến tính tách đôi sợi DNA: Được thực hiện ở nhiệt độ cao hơn nhiệt độ nóng chảy của phân tử (94 – 95 0 C) trong vòng 30 – 60 giây. Lúc này, phân tử DNA mạch kép sẽ được tách thành hai mạch đơn (đóng vai trò là mạch khuôn cho sự tổng hợp hai mạch bổ sung mới).

    Bước 2: Bắt cặp mồi: Được thực hiện ở nhiệt độ thấp hơn so với nhiệt độ nóng chảy (Tm) của các Primer, nhiệt độ dao động trong khoảng 55 – 65 0 C. Thời gian bắt cặp kéo dài từ 30 – 60 giây tùy vào Tm của các primer.

    Bước 3: Kéo dài: Được thức hiện ở nhiệt độ 72 0 C giúp cho DNA polymerase có môi trường hoạt động tốt nhất. Lúc này, dưới tác động của DNA polymerase, các nucleotide sẽ lần lượt gắn vào primer theo nguyên tắc bổ sung với mạch khuôn. Thời gian kéo dài khoảng 30 giây đến vài phút tùy thuộc vào độ dài của trình tự DNA khuếch đại.

    Qua 3 bước, một DNA đích sẽ được nhân lên thành hai bản sao và chu kỳ được lặp đi lặp lại liên tục từ 30 – 40 chu kỳ. Lúc này, từ một DNA đích sẽ nhân lên thành 2 30 đến 2 40 bản sao, tức là hàng tỷ bản sao.

    3. Cấu tạo máy PCR

    Mỗi loại máy PCR lại có cấu tạo khác nhau. Bạn có thể lựa chọn PCR với 2 hoặc 3 block hoặc block thông thường 96 giếng, hoặc cũng có thể lựa chọn các loại máy PCR cầm tay để đem đi hiện trường. Ở nhiều trung tâm nghiên cứu hay bệnh viện lớn họ thường xây dựng series nhiều máy luân nhiệt được liên kết với nhau để tạo ra một hệ thống máy PCR lớn và được điểu khiển bởi một hệ thống máy tính trung tâm hiện đại.


    Kỹ thuật PCR đem đến nhiều ưu điểm vượt trội hơn hẳn so với các xét nghiệm thông thường khác như:

    • Kết quả thu được chính xác trong vài giờ.
    • Phát hiện được các virus, vi khuẩn gây bệnh.
    • Cho phép xác định được các tác nhân vi sinh không thể nuôi cấy trong phòng thí nghiệm lâm sàng vì khả năng dịch cao hay khó nuôi cấy.
    • Phát hiện sớm các đột biến gen gây ung thư, bệnh di truyền,…
    • Xác định huyết thống giữa các cá thể khác nhau.


    Hiện nay, kỹ thuật PCR được sử dụng phổ biến trong việc chẩn đoán bệnh trên gia súc, gia cầm, thủy sản,… nhằm phát hiện sớm và đưa ra hướng điều trị hiệu quả.

    Kỹ thuật PCR có thể chẩn đoán được hầu hết các bệnh nguy hiểm trên vật nuôi:

    • Bệnh trên lợn: Dịch tả lợn Châu Phi, dịch tả lợn cổ điển, giả dại, đóng dấu lợn,…
    • Bệnh trên gia cầm: CRD, Marek, Leucosis, Newcastle,…
    • Bệnh trên bò: Bò điên, tụ huyết trùng trâu bò, tiêu chảy do virus trên bò,…
    • Bệnh trên chó: Parvo, Care, bệnh lỵ do Giardia intestinalis,….
    • Bệnh trên tôm: Vi bào tử trùng, đốm trắng, Taura, hoại tử gan tụy,…

    HappyVet giới thiệu cho người nuôi hệ thống máy PCR Pockit được thiết kế linh hoạt, cho phép đồng thời chẩn đoán được nhiều bệnh trong một lần chạy mẫu, cho kết quả trong vài giờ đồng hồ.

    1. Máy Pockit Central

    Pockit Central là thiết bị PCR được sử dụng trong phòng thí nghiệm. Máy được tích hợp đồng thời hệ thống ly trích Acid Nucleic và phản ứng iiPCR giúp rút ngắn thời gian chẩn đoán mầm bệnh. Thao tác thực hiện đơn giản, chỉ cần đưa mẫu vào máy và bấm nút và chờ kết quả.

    2. Máy Pockit Xpss

    Pockit Xpss là một trong những loại máy PCR đang được rất nhiều bà con lựa chọn. Sản phẩm được thiết kế như một phòng thí nghiệm thu nhỏ, toàn bộ hệ thống chẩn đoán được đặt trong một chiếc vali xách tay vận chuyễn dễ dàng đến các trang trại, các cửa khẩu hay các vùng dịch, giúp phát hiện nhanh mầm bệnh.

    Hệ thống PCR được thiết kế linh hoạt, một chương trình có thể ứng dụng cho tất cả các chỉ tiêu và cho phép chẩn đoán được nhiều bệnh trong một lần chạy mẫu.

    3. Máy Pockit Pro

    Pockit Pro cũng được vận hành dựa trên phương pháp iiPCR, cho kết quả nhanh chóng trên màn hình LCD và tự động lưu vào thẻ SD. Sản phẩm được thiết kế linh hoạt, một chương trình có thể ứng dụng cho tất cả các chỉ tiêu, đồng thời cho phép chẩn đoán nhiều bệnh chỉ trong một lần chạy mẫu.

    4. Máy Pockit micro

    Pockit micro là một trong những dòng thế hệ mới của phương pháp iiPCR với độ nhạy cao, cho kết quả chính xác, thiết kế dạng cầm tay và dễ dàng đọc kết quả âm tính hoặc dương tính trên màn hình.

    • Số mẫu: 1 – 4 mẫu/ lần
    • Thời gian: 30 phút
    • Khối lượng: 380g

    5. Máy Pcokit micro Plus

    Máy pcr cầm tay Pockit micro Plus cũng là thế hệ mới nhất của phương pháp iiPCR với nhiều cải tiến trong thiết kế như trọng lượng nhẹ, pin sạc tích hợp, dễ dàng sử dụng và có thể vận hành ở mọi nơi và mọi thời điểm.

    Hình ảnh máy PCR cầm tay Pockit micro Plus

    6. Máy Pockit micro Duo

    Micro Duo là dòng sản phẩm mới nhất của series máy phân tích cầm tay Pockit Micro với hai bước sóng chẩn đoán 520nm, 550nm. Sản phẩm có khả năng chẩn đoán chính xác mầm bệnh do virus, vi khuẩn gây ra trên thú y.

    --- Bài cũ hơn ---

  • Các Quy Trình Xét Nghiệm Chẩn Đoán
  • Xét Nghiệm Phát Hiện Bệnh Lậu Bằng Phương Pháp Pcr
  • Kiểm Nghiệm Salmonella Bằng Phương Pháp Real
  • Nguyên Tắc Real Time Pcr
  • Phương Pháp Real Time Pcr Với Kit Iiq
  • Các Kỹ Thuật Pcr Và Ứng Dụng

    --- Bài mới hơn ---

  • Máy Pcr Là Gì? Công Dụng Của Máy Pcr Pockit Cầm Tay
  • Khái Quát Về Kỹ Thuật Real Time Pcr Là Gì? Ứng Dụng Chẩn Đoán Bệnh Tôm
  • Pcr Là Gì? Nguyên Tắc, Qúa Trình & Ứng Dụng Của Máy Chu Kỳ Nhiệt
  • Pcr Nguyên Tắc Và Ứng Dụng
  • Việt Nam Bổ Sung Phương Pháp Xét Nghiệm Ncov Mới
  • (Restriction Fragment Length Polymorphisms) I. Giới thiệu

    Kỹ thuật RFLP là kỹ thuật nghiên cứu tính đa hình chiều dài của các phân đoạn DNA dựa trên điểm cắt các enzim giới hạn (Restriction Enzyme, RE). Khi ủ DNA với enzim giới hạn ở dung dịch đệm thích hợp ở pH, nhiệt độ thích hợp sẽ sẽ tạo ra những phân đoạn DNA với kích thước khác nhau, từ đó lập nên các bản đồ gen. Kỹ thuật này được sử dụng phổ biến từ thập niên 80 đến nay.

    II. Nguyên tắc chung

    Nguyên tắc của kỹ thuật này dựa trên độ đặc hiệu của các enzim cắt giới hạn (restriction enzim-RE) đối với vị trí nhận biết của chúng trên DNA bộ gen. Sự khác biệt vị trí cắt giữa hai cá thể sẽ tạo ra những phân đoạn cắt khác nhau.

    III. Các enzim giới hạn (RE) 1. Giới thiệu

    Enzim giới hạn được Werner Arber tìm thấy ở vi khuẩn vào năm 1962. Ông cho rằng các RE có khả năng rất đặc biệt đó là khả năng nhận biết DNA chủ và DNA lạ. Enzim này hạn chế sự nhân lên của DNA lạ khi chúng xâm nhập vào tế bào vi khuẩn bằng cách cắt chúng ra thành từng đoạn một cách đặc hiệu, vì thế ông gọi là restriction có nghĩa là hạn chế. Với phát minh này ông cùng các cộng sự (Daniel Nathans và Hamilton O. Smith) đã giành giải thưởng Nobel vào năm 1978.

    Các RE hợp thành hệ thống bảo vệ ở tế bào sơ hạch (procaryote), một câu hỏi đặt ra là vì sao các RE chỉ cắt DNA của các phage mà không cắt DNA của tế bào vi khuẩn? Câu trả lời là nhờ Methylase đây là enzim giúp vi khuẩn có khả năng này, chính enzim này chịu trách nhiệm gắn nhóm metyl (CH 3) vào các nucleotides ở vị trí cắt của các RE trên DNA của vi khuẩn vì thế bảo vệ DNA của vi khuẩn khỏi sự phân cắt của RE. Tuy vậy đôi lúc methylase lại gắn nhằm cả nhóm metyl vào chính DNA của phage, điều này giải thích vì sao đối với các dòng vi khuẩn kháng phage vẫn có các tế bào bị phân hủy.

    Enzim cắt giới hạn đầu tiên được phân lập vào năm 1968, cho đến nay có khoảng 3.400 RE được khám phá. Trong số này có khoảng 540 RE đã được thương mại hóa.

    2. Tên gọi của enzim cắt giới hạn

    Chữ đầu viết hoa là chữ đầu tên vi khuẩn từ đó RE được ly trích.

    Hai chữ kế không viết hoa tương đương với tên loài của vi khuẩn. Cả 3 chữ nầy đều viết in nghiêng. Kế đến là chữ số la mã chỉ thứ tự RE được phát hiện trong trường hợp nhiều RE được tìm thấy trong cùng một vi khuẩn.

    Đôi khi còn có thêm chữ viết hoa (viết thẳng) để chỉ chủng vi khuẩn sử dụng

    VD : Escherichia coli Ry13

    chi loài chủng

    EcoRI: là enzym đầu tiên tìm thấy trên vi khuẩn E. coli

    EcoRV: enzym thứ 5 tìm thấy trên vi khuẩn E.coli

    3. Các loại enzim cắt giới hạn

    Loại I: khi enzym nhận biết trình tự nó sẽ di chuyển trên phân tử DNA cách đó 1000-5000 nu và giải phóng độ vài chục nu.

    Loại II: enzym nhận biết trình tự và cắt ngay vị trí đó.

    Loại III: enzym nhận biết trình tự và cắt DNA ở vị trí cách đó 20 nu.

    III. Quy trình thực hiện RFLP bao gồm các bước:

    + Tách chiết và tinh sạch DNA

    + Cắt các mẫu DNA cần phân tích bởi RE

    + Phân tách DNA trên gel agarose

    + Southern Blotting

    Chuyển DNA sang màng nylon

    Chọn đoạn dò (probes), đánh dấu đoạn dò

    Lai ghép gen (Hybridization)

    Lập bản đồ gen (phân tích đa hình)

    1. a. Nguyên tắc: Thành tế bào bị phá vỡ bằng biện pháp cơ học và các chất tẩy mạnh. DNA được giải phóng và làm sạch tạp chất Rnase. DNA được kết tủa trong Ethanol 100% và thu lại nhờ ly tâm.
    2. b. Quy trình: Thực hiện theo qui trình được mô tả bởi Rogers và Bendich (1988) (qui trình CTAB) gồm các bước sau:

    – Lấy lá của đối tượng cần nghiên cứu.

    – Khử trùng bề mặt lá bằng cồn 70%, sau đó dùng kéo và kẹp (đã được khử trùng) cắt lá thành từng mảnh nhỏ rồi cho riêng vào các tuýp (mỗi mẫu riêng một tuýp khoảng 0,1g).

    – Ngâm các tuýp và dụng cụ nghiền mẫu vào nitơ lỏng trong 10 phút.

    – Cho mẫu vào máy nghiền, có tần số 27lần/giây, lập lại khoảng 3 lần.

    – Cho thêm 1.000µl Extraction buffer (10ml EB +7µl β-Mercaptoethanol).

    – Cho thêm 50µl SDS 10%.

    – Ủ trong nước 65 o C trong 30 phút. Sau 5 phút trở mặt mẫu một lần.

    – Ly tâm 13.000 rpm trong 10 phút.

    – Lấy 800µl dịch trong ở trên cho vào tuýp mới (bỏ phần cặn)

    – Cho 800µl Isopropanol vào mỗi tuýp, lắc đều.

    – Ủ mẫu ở -20 o C trong 2 giờ.

    – Ly tâm 13.000rpm trong 10 phút, bỏ nước, lấy cặn.

    – Cho thêm 400µl TE 0,1 vào, thêm 10µl RNase, ủ 20 phút ở 37 o C.

    – Cho 400µl CTAB vào, ủ 15 phút ở 65 o C.

    – Cho 800µl Chloroform/Isoamylalcohol, đảo nhẹ

    (12ml Chloroform: 0,5ml Isoamylalcohol)

    – Ly tâm 13.000rpm trong 5 phút.

    – Lấy 700µl phần trong chuyển sang tuýp mới.

    – Cho 1,4ml Ethanol 96% làm lạnh vào, lắc nhẹ, để 15 phút ở nhiệt độ phòng.

    – Ly tâm 13.000rpm trong 10 phút, bỏ nước, lấy cặn.

    – Cho 700µl Ethanol 70% làm lạnh vào, lắc nhẹ.

    – Ly tâm 13.000rpm trong 10 phút, bỏ nước, lấy cặn.

    – Lặp lại lần nữa với Ethanol 70% làm lạnh, thấm miệng tuýp trên giấy.

    – Sấy chân không ở 45 o C trong 10 phút.

    – Cho 200µl TE 0,1 vào, trữ mẫu ở -20 o C.

    c. Xác định nồng độ DNA bằng phương pháp đo quang phổ Nguyên tắc:

    – Dựa vào sự hấp thụ mạnh ánh sáng tử ngoại ở bước sóng 260 nm và 280 nm của các bazơ purin và pyrimidin.

    – Đơn vị OD260 nm tương ứng nồng độ 50mg/ml cho một dung dịch DNA sợi đôi. Do đó nồng độ DNA trong mẫu được tính theo công thức sau:

    * Ví dụ, đoạn mồi CAGCAAATATCTGTCCTTAC thì nhiệt độ gắn mồi:

    Tm = 0 C

    VI. Điều kiện phản ứng PCR

    Ðể thử nghiệm PCR có thể chạy được, cần phải có đầy đủ các thành phần sau đây:

    1. Nước

    Nước sử dụng cho phản ứng PCR phải thật tinh khiết, không chứa ion nào, không chứa DNAase, RNAase, enzim cắt giới hạn…Nói cách khác là không chứa bất kỳ một thành phần nào khác.

    2. Dung dịch đệm cho phản ứng PCR:

    Dung dịch đệm cho PCR là một trong những yếu tố quan trọng ảnh hưởng đến chất lượng phản ứng PCR.

    Thành phần dung dịch đệm của phản ứng PCR thường phụ thuộc vào loại enzim DNA polymerase sử dụng trong PCR, thường chứa muối đệm Tris HCl 10 mM, KCl50mM và MgCl 2 1.5mM. Ngoài ra dung dịch đệm PCR còn có thể chứa 0.001% BSA hay Gelatine và trong một số phản ứng PCR còn có thể thêm tween hay formamide nữa. Trong các thành phần trên, có lẽ ảnh hưởng lên thử nghiệm PCR nhiều nhất là nồng độ MgCl 2, vì vậy để có được một thử nghiệm PCR có độ nhạy cao, phản ứng rõ nét, người ta phải tối ưu hóa phản ứng bằng cách thăm dò một nồng độ MgCl 2 thích hợp nhất.

    Nồng độ MgCl 2 có thể dao động từ 0.5-5 mM. Chính ion Mg 2+ gắn liên kết dNTP với DNA polymerase, tăng khả năng bám nối của mồi. Nồng độ MgCl 2 cao sẽ tạo nhiều sản phẩm không đặc hiệu, nồng độ MgCl 2 quá thấp sẽ không tạo sản phẩm PCR.

    3. dNTP (deoxy nucleoside triphosphate), tức là đơn vị để có thể tổng hợp được các bản sao của DNA đích. dNTP có cấu tạo gồm một đường deoxyribose có gắn một base, có thể là Adenine (dATP) hay Thymine (dTTP) hay Cytosine (dCTP) hay Guanine (dGTP) , ở carbone số 1 (C1). Ba phân tử phosphate (triphosphate) được gắn tại carbone số 5 (C5) của phân tử deoxyribose này và đây chính là nơi mà dNTP gắn vào đầu 3′ của chuỗi bổ sung trên chuỗi DNA đích. Năng lượng để cho phản ứng này xảy ra được lấy từ các nối phosphate giàu năng lượng của triphosphate trên dNTP. Ðó cũng chính là lý do tại sao phải là dNTP chứng không phải là dNDP (diphosphate) hay dNMP(monophosphate).

    Mồi (primer)

    Mồi là những đoạn DNA sợi đơn ngắn và cần thiết cho việc xúc tiến phản ứng dây chuyền tổng hợp DNA. Chúng nhận ra phần DNA cần được nhân lên, bắt cặp bổ sung với một đầu của DNA mẫu và tạo ra vị trí bắt đầu tái bản. Các mồi này có chiều ngược nhau, bao gồm một mồi xuôi (forward primer) và một mồi ngược (reverse primer).

    Mồi là yếu tố quan trọng nhất của phản ứng PCR, quyết định tính đặc hiệu

    của phản ứng

    Trong thử nghiệm PCR, đoạn mồi có hai vai trò chính : (1) Quyết định nên tính đặc hiệu của thử nghiệm, vì nếu đoạn mồi được chọn càng đặc hiệu cho chuỗi đích, nghĩa là chỉ có thể bắt cặp trên chuỗi đích mà không thể bắt cặp được trên các chuỗi DNA khác ngoài chuỗi đích, thì sản phẩm PCR càng đặc hiệu và thử nghiệm PCR càng đặc hiệu. (2) Khởi động men polymerase vì men polymerase chỉ có thể bắt đầu tổng hợp sợi bổ sung cho chuỗi DNA đích một khi nó nhận dạng được đầu 3′ (là đầu mà nó xúc tác cho một dNTP được gắn vào) đang ở tình trạng sợi đôi

    5. Enzim DNA polymerase (Taq)

    Là enzim xúc tác cho quá trình lắp ráp các nucleotide A, T, G, C vào mạch DNA mới tổng hợp, phải là men polymerase chịu được nhiệt độ cao.

    Vào thập niên 1960, nhà Vi sinh vật học Thomas Brock đã đến Công viên Quốc gia Yellowstone (Bang Wyoming, Mỹ) để nghiên cứu các vi sinh vật ưa nhiệt sống trong suối nước nóng 80-90 0C. Ông đã phát hiện một loài vi khuẩn phát triển mạnh ở nhiệt độ cao, có tên là Thermus aquaticus. Hai mươi năm sau, các nhà khoa học của tập đoàn Cetus (Tập đoàn Công nghệ Sinh học California) đã nhận thấy rằng DNA polymerase từ Thermus aquaticus (Taq-polymerase) có khả năng giải quyết vấn đề của enzim biến tính sau mỗi chu kỳ. DNA polymerase chịu nhiệt sử dụng cho phản ứng PCR lần đầu tiên được bán trên thị trường là Taq-polymerase. Từ đó đến nay, một số vi sinh vật chịu nhiệt khác đã được khám phá và người ta đã tách chiết thêm được các DNA polymerase chịu nhiệt để sử dụng cho phản ứng PCR như Vent– polymerase (Tli-polymerase), Pfu– polymerase, rTth

    6. DNA mẫu (DNA template) là mẫu DNA mà chúng ta sẽ khuếch đại. Có thể là DNA kép, đơn, hoặc RNA được tách chiết từ các đối tượng nghiên cứu. DNA khuôn có độ nguyên vẹn cao tránh lẫn tạp chất.

    VII. Chu kỳ nhiệt

    Có 3 giai đoạn chính trong phản ứng PCR và chúng được lặp đi lặp lại nhiều lần (chu kỳ) (thường từ 25 đến 75 chu kỳ).

    * Giai đoạn biến tính (denaturation): tách chuỗi DNA từ sợi đôi tách thành 2 sợi đơn. Nhiệt độ tăng lên 94-96°C để tách hai sợi DNA ra. Bước này gọi là biến tính, nhiệt độ tăng lên sẽ phá vỡ cầu nối hydrogen của chuỗi DNA. Trước chu kỳ 1, DNA thường được biến tính đến thời gian mở chuỗi để đảm bảo mẫu DNA và mồi được phân tách hoàn toàn và chỉ còn dạng sợi đơn. Thời gian ở giai đoạn này khoảng : 1-2 phút.

    * Giai đoạn bắt cặp (annealing): gắn cặp mồi đặc trưng theo nguyên tắc bổ sung. Sau khi 2 sợi DNA tách ra, nhiệt độ được hạ xuống để mồi có thể gắn vào sợi DNA đơn. Nhiệt độ giai đoạn này phụ thuộc vào đoạn mồi và thường thấp hơn nhiệt độ biến tính khoảng 45-60°C. Sử dụng sai nhiệt độ trong giai đoạn này dẫn đến việc đoạn mồi không gắn hoàn toàn vào DNA mẫu, hay gắn một cách tùy tiện. Thời gian bắt cặp từ 1-2phút.

    * Giai đoạn kéo dài (extension): tổng hợp chuỗi DNA mới giống chuỗi DNA gốc. DNA polymerase gắn tiếp vào sợi trống. Nó bắt đầu bám vào và hoạt động dọc theo sợi DNA. Nhiệt độ kéo dài phụ thuộc DNA-polymerase. Thời gian của bước này phụ thuộc vào cả DNA-polymerase và chiều dài mảnh DNA cần khuếch đại. Như một quy tắc 1000bp/ 1 phút .

    Các đoạn DNA mới được hình thành lại được sử làm khuôn để tổng hợp cho các chu kỳ tiếp theo.

    Như vậy số lượng bản sao sẽ tăng gấp 2 sau mỗi chu kỳ và sau n chu kỳ, tính theo lý thuyết số lượng bản sao là 2n

    VI. Các ứng dụng

    Kỹ thuật PCR được ứng dụng rộng rãi trong nhiều lĩnh vực khác nhau, từ nghiên cứu khoa học đến sản xuất và đời sống xã hội. Những ứng dụng chính của kỹ thuật PCR là:

    – Xác định các đoạn trình tự cần nghiên cứu

    – Phát hiện đột biến

    – Nghiên cứu quá trình tiến hoá phân tử

    – Phục hồi các gen đã tồn tại hàng triệu năm

    – Chọn giống vật nuôi, cây trồng

    – Lựa chọn các cặp cha mẹ thuần chủng trong thời gian ngắn

    – Xác định các loài mới, các loài đặc hữu bằng phưng pháp di truyền phân tử

    Y học – Khoa học hình sự.

    – Chuẩn đoán chính xác các bệnh nhiễm trùng từ vi khuẩn, nấm, virus

    – Chuẩn đoán sớm các bệnh gây ra do ung thư, các bệnh di truyền

    – Xác định huyết thống, truy tìm dấu vết tội phạm

    – Là kỹ thuật nền cho các kỹ thuật khác như: RAPD, SSR…

    + Nguyễn Thị Thu Lan, Nguyễn Hoàng Chương, Hồ Huỳnh Thuỳ Dương, Huỳnh Thị Lệ Duyên, Phan Kim Ngọc. 2003. Xác định giới tính ở heo bằng kỹ thuật PCR. Tạp chí di truyền & ứng dụng ,Số 4.

    + Tang và ctv (2000) đã dùng kỹ thuật PCR competitive để định lượng WSSV (White Spot Syndrome Virus) nhiễm trong Penaeus monodon Fabricius để phân loại giai đoạn nhiễm WSSV thành mức độ nhẹ, trung bình và nặng, từ đó có cách xử lý thích hợp làm giảm thiệt hại trong nghề nuôi tôm (Tang, K. F. J., Lightner D. V.,2000. Quantification of white spot syndrome virus DNA throught a competitive polymerase chain reaction. Aquaculture, 189:11-21)

    + Phát hiện nhanh Salmonella spp. trong thực phẩm (Phẩm Minh Thu, Phan Thu Dòng, Trương Xuân Liên và cộng sự. Viện Pasteur TP.HCM)

    + Áp dụng kỹ thuật PCR sản xuất Bộ KIT chuẩn đoán bệnh đốm trắng trên tôm, bệnh vàng lá gân xanh. Viện NC&PT Công nghệ Sinh học- Đại học Cần Thơ.


    I. Kỹ thuật RAPD (Random Amplified Polymorphic DNA)

    1. Giới thiệu

    Là phương pháp phân tích đa dạng DNA khuyếch đại ngẫu nhiên, kỹ thuật này được phát hiện vào năm 1990 (Welsh và McClelland; William và ctv.). Dùng nghiên cứu sự khác biệt di truyền của những loài khác nhau. Mồi được sử dụng trong kỹ thuật RAPD là những sợi oligonucleotide gồm 10-mer có trình tự sắp xếp ngẫu nhiên. Các sản phẩm RAPD được phân tích bằng cách điện di trên gel agarose. Hệ gen của hai loài khác nhau sẽ cho những đoạn băng trên gel khác nhau, từ đó có thể so sánh sự đa dạng sinh học của các giống cây.

    2. Nguyên tắc

    Kỹ thuật RAPD dựa trên kỹ thuật PCR, bằng cách sử dụng những primer ngắn (khoảng 10 nucleotide) có trình tự biết trước, bắt cặp và nhân bản ngẫu nhiên những đoạn DNA có trình tự bổ sung với trình tự của các primer. Các đoạn mồi oligonucleotide nếu bắt cặp ngẫu nhiên với cả hai mạch đối diện của mạch khuôn DNA trong khoảng cách có thể khuếch đại được (dưới 3000bp) sẽ cho ra những đoạn DNA có kích thước khác nhau sau khi khuếch đại. Sự có mặt của các sản phẩm DNA khác nhau chứng tỏ đã có một sự tương đồng hoàn toàn hay một phần giữa DNA bộ gen và mồi. Các mồi dùng trong RAPD thường ngắn vì vậy dễ dàng tìm được các đoạn tương đồng trên mạch đơn DNA bộ gen. Do đó tính đa dạng thu được nhờ RAPD là đáng tin cậy, vì khi có sự thay đổi một base nitơ nào đó thì nó sẽ ngăn cản việc tiếp hợp giữa mồi và DNA mạch khuôn. Sự mất đoạn nhiễm sắc thể hoặc sự thêm bớt điểm gắn mồi cũng như sự xen vào của một gen nào đó sẽ làm thay đổi kích thước đoạn DNA được khuếch

    Dùng nhiều primer khác nhau sẽ khuếch đại nhiều đoạn gen với kích thước khác nhau, kết quả này được thể hiện trên gel với nhiều băng (band) ở những vị trí khác nhau, các băng đa hình được ghi nhận và từ đó có thể vẽ được bản đồ trên một quần thể đang phân ly.

    Sinh vật cùng loài sẽ có kiểu gen hoàn toàn giống nhau, sẽ khuyếch đại các đoạn DNA có kích thước giống nhau khi sử dụng bất kỳ mồi ngẫu nhiên nào để chạy PCR. Sinh vật khác nhau ít nhiều sẽ khác nhau về kiểu gen _ đa dạng về sinh học, thì với một số mồi ngẫu nhiên nào đó các đoạn DNA được khuyếch đại sẽ có kích thước khác nhau.

    Là đoạn ngắn oligonucleotide đơn (10 nu) được tổng hợp một cách ngẫu nhiên, có hàm lượng G+C từ 60-70%, và không có đầu tự bổ sung.

    Để tìm sự khác biệt giữa các loài, người ta thường sử dụng một số lượng lớn các mồi ngẫu nhiên.

    Trên thị trường hiện nay có rất nhiều mồi ngẫu nhiên được tổng hợp nhân tạo.

    3. Qui trình thực hiện kỹ thuật RAPD

    – Thiết kế mồi

    – Chuẩn bị mẫu DNA: mẫu DNA được ly trích phải đủ thuần, Ít tạp chất.

    – Pha mix cho phản ứng PCR với các thành phần theo thứ tự sau:

    H 2 O tiệt trùng, Buffer, dNTP tổng số, mồi xuôi, mồi ngược, Taq polymerase, DNA mẫu.

    – Cho vào máy lập chương trình chạy phù hợp

    – Kiểm tra sản phẩm PCR trên gel agarose với sự có mặt của thang chuẩn

    – Phân tích kết quả bằng phần mềm BioPRO.

    – Xác định tính di truyền bằng các phần mềm thông dụng. Các số liệu thu được cho thấy sự gần gũi hay cách biệt di truyền của các mẫu nghiên cứu.

    – Hệ số đồng dạng di truyền có thể được tính theo công thức của M. Nei & Li (1979)

    N i: số vạch của giống i

    N j: số vạch của giống j

    N ij: số vạch chung của 2 giống i và j

    4.Ứng dụng

    Kỹ thuật RAPD được ứng dụng đê nghiên cứu đa dạng di truyền của các giống.

    Thiết lập bản đồ di truyền: từ quần thể cha mẹ F1 và quần thể phân ly F2, người ta có thể đánh giá các băng hiện diện , sau đó dùng phần mềm phổ biến hiện nay là Mapmarker để thiết lập bản đồ di truyền.

    Sử dụng kỹ thuật RAPD “Nghiên cứu đa dạng sinh học của giống cây có múi ở huyện Gò Quao, tỉnh Kiên Giang”. Nhóm nghiên cứu đã sử dụng 4 mồi A02, A04, A11 và A13 trong phân tích đa dạng di truyền ; kết quả có 49 dấu phân tử được ghi nhận. Từ đó vẽ được giản đồ phả hệ của các giống cây này. Nguyễn Hữu Hiệp, Trần Nhân Dũng, Đặng Thanh Sơn và Nguyễn Văn Được. Tạp chí Khoa học 2004:1, trang 105-114.

    Phương pháp RAPD có những nhược điểm:

    Sự xuất hiện các băng tính trội, điều đó không phân biệt được cá thể đồng hợp tử và cá thể dị hợp tử.

    Tính lập lại không cao do primer là primer ngẫu nhiên và phụ thuộc điều kiện phản ứng PCR.

    Trở ngại trong việc giải thích các băng có cùng tóc độ di chuyển.

    Những ưu điểm nổi bật của kỹ thuật RAPD:

    Phương pháp phát hiện nhanh tính đa dạng di truyền

    Đơn giản, không dòi hỏi kỹ thuật cao.

    Tương đối rẽ tiền so với các phương pháp khác như RFLP, SSR…

    Không dùng đồng vị phóng xạ.

    kỹ thuật AFLP

    I. Giới thiệu

    Kỹ thuật AFLP (Amplified Fragments Length Polymorphism) được hiểu là sự đa dạng của các đoạn DNA được nhân lên có định hướng sau khi bị cắt bởi 2 enzim giới hạn, sử dụng những phân đoạn DNA làm khuôn cho phản ứng khuếch đại PCR. AFLP là một trong những kỹ thuật in dấu DNA được phát triển bởi Vos và cộng sự năm 1995. Kỹ thuật này là một công cụ hữu ích để xác nhận nhiều loci của đa hình DNA mà không cần phải biết trước thông tin về trình tự DNA của chúng (Michelmore và ctv., 1998), phương pháp này có thể đưa ra nhanh chóng một ước lượng độ đa dạng di truyền trong và giữa những quần thể với nhau (Breyen và ctv., 1997; Cervera và ctv.,1996)

    II. Nguyên tắc

    Nguyên tắc của phương pháp AFLP cũng giống như RFLP, điểm khác biệt cơ bản là AFLP không cần tiến hành lai phân tử (lai Southern blot ), do vậy thực hiện nhanh hơn. Kỹ thuật AFLP gồm hai nội dung cơ bản là:

    – Cắt DNA bằng enzim giới hạn có bổ sung các adaptor đặc hiệu tạo nên các đoạn mút giống nhau, đặc trưng cho các mồi đã chọn trước. Cặp enzyme thường được dùng nhất là E coRI – M se I. Đoạn adaptor gồm 2 phần: phần trình tự lõi và phần trình tự đặc hiệu cho vị trí cắt enzyme.

    – Khuếch đại đoạn DNA bằng kỹ thuật PCR ngắt quãng với hai loại mồi khác nhau. Mồi của phản ứng PCR được thiết kế dựa trên trình tự adaptor và chứa một trình tự chọn lọc khoảng vài nucleotide. Chỉ những phân đoạn DNA nào chứa cả trình tự adaptor và trình tự nucleotide chọn lọc mới được khuếch đại, chính trình tự chọn lọc sẽ làm giảm sự xuất hiện sản phẩm PCR và làm đơn giản quá trình phân tích.

    I. Kỹ thuật AFLP

    1. Qui trình

    Qui trình thực hiện AFLP gồm bốn bước:

    Bước 1: Digestion

    Dùng 2 enzim giới hạn EcoRI (ít có = 4096 bases) có trình tự nhận biết 6 base và MseI (thường có = 256 bases) có trình tự nhận biết 4 base, cắt DNA khuôn thành những phân đoạn. Hai enzym giới hạn này được dùng để sắp xếp lại DNA nhờ kết hợp với 2 adaptor có cấu trúc làm cho dây DNA không trở lại hình dạng ban đầu

    Vị trí cắt của enzim

    Eco RI = 5′-G AATT C-3′

    3′-C TTAA G-5′

    Mse I = 5′-T TA A-3′

    3′-A AT T-5′

    Bước 2 : Ligation

    Nối với EcoRI adaptor và Mse I adaptor, là những oligonucleotide sợi đôi gắn vào 2 đầu phân đoạn DNA. Cấu trúc của 2 adaptor như sau :

    Eco RI-adaptor



    Mse I-adaptor



    Bước 3 : Tiền khuếch đại

    – Chạy PCR với các mồi (primer) chọn lọc, các mồi này được cấu tạo gồm 3 phần : trình tự nồng cốt (CORE) + trình tự theo enzim (ENZ) + trình tự chọn lọc (EXT) (theo định hướng của người nghiên cứu ký hiệu là NNN, có thể là TGA hoặc AAC hoặc CTG…)

    Nhờ vậy, chỉ những phân đoạn có nu bổ sung được với nu chọn lọc được nhân lên. Sự khuếch đại chọn lọc như vậy làm giảm số lượng phân đoạn hàng ngàn lần. Chỉ những đoạn DNA ngắn có một đầu là primer MseI và một đầu là primer EcoRI là được khuếch đại đáng kể, các đoạn có hai đầu là EcoRI bị mất đi do số lượng ít và hai đầu là Mse I tự tạo thành vòng nhỏ DNA do cạnh tranh với primer. Sản phẩm tiền phản ứng được pha loãng và được dùng làm vật liệu để khuếch đại với đoạn mồi chọn lọc màu huỳnh quang.

    Bước 4 : Khuếch đại

    Sản phẩm PCR của bước tiền khuếch đại được dùng làm khuôn cho bước khuếch đại sau đó, sử dụng primer có gắn 3 nu chọn lọc ở đầu 3′ và chỉ EcoRI primer được đánh dấu huỳnh quang ở đầu 5′. Vì vậy, chỉ những sợi chứa Eco RI được phát hiện trên máy ABI 310. PCR được xảy ra với thông số miêu tả bởi Cervera và ctv (1996). Phản ứng bắt đầu với nhiệt độ cao gắn mồi tối hảo cho mồi chọn lọc. Nhiệt độ này giảm dần sẽ làm tăng sự kết hợp. Sử dụng primer gắn với 3 nu chọn lọc sẽ giúp hạn chế việc bắt cặp sai (mismatch), chỉ nhân lên một số lượng lớn những băng chuyên biệt.

    Ngoài ra, việc khuếch đại qua 2 bước có những thuận lợi hơn khuếch đại trực tiếp như:

    – Phổ diện rõ hơn vì không có quá nhiều loại marker.

    – Qua bước tiền khuếch đại, tạo lượng lớn DNA khuôn cho sự khuếch đại dễ dàng và hiệu quả hơn.

    – Sau khi xong phản ứng, mẫu được biến tính bằng cách thêm một lượng tương đương thể tích 15µl dung dịch đệm Formamide và đun nóng 5′ ở 95 o C. 1ml mỗi mẫu được nạp tự động vào ống mao quản (capilary) polymer ABI 310.

    Hình : các bước thực hiện kỹ thuật AFLP

    2. Ưu và nhược điểm của kỹ thuật AFLP

    Ưu điểm của kỹ thuật AFLP

    – AFLP không phức tạp như RFLP nhưng vẫn khảo sát được toàn bộ gen.

    – Có tính lặp lại cao hơn RAPD và chỉ cần sử dụng một lượng nhỏ DNA ban đầu (2.5pg-25ng)

    – Khuếch đại có chọn lọc một lượng lớn các đoạn DNA đa hình (polymorphism) trong một phản ứng PCR, phù hợp cho việc phân tích đa dạng giữa các quần thể có quan hệ gần nhau.

    – Không cần biết trước trình tự DNA của gen cần nghiên cứu, không cần sử dụng nhiều loại primer.

    – Là kỹ thuật in dấu DNA còn khá mới lạ nhưng rất hiệu quả, có thể in dấu DNA của bất kỳ nguồn gốc phức tạp nào từ sinh vật sơ hạch, thực vật, động vật đến con người.

    Nhược điểm

    – Tuy nhiên AFLP là một marker trội, điều này làm hạn chế phân biệt cá thể đồng hợp và dị hợp.

    – Qui trình dài, phức tạp, tốn nhiều thời gian thực hiện.

    – Lệ thuộc nhiều vào thao tác ở những bước đầu để có được phổ diện các phân đoạn DNA lý tưởng.

    III. Ứng dụng

    – In dấu DNA, lập bản đồ DNA marker có hiệu quả nhất so với những marker khác (Vos và ctv., 1995).

    – Tạo nhóm liên kết di truyền giữa các giống.

    – Đánh giá mức độ liên hệ di truyền hoặc sự khác nhau giữa các giống.

    – Là công cụ hiệu quả để phát hiện tính chất đa hình nên dễ dàng nhận biết sự khác biệt giữa các cá thể.

      Travis và cộng sự đã ứng dụng kỹ thuật AFLP để đánh gía sự đa dạng di truyền giữa tất cả những quần thể của Astragalus cremnophylax . Chín loại mồi đã được sử dụng để cho ra 325 vạch của 143 cá thể được thu mẫu từ ba quần thể. Từ kết quả phân tích được, Travis và cộng tác viên (1996) có thể biểu thị đặc điểm của sự đa dạng di truyền và cấu trúc quần thể của chúng và đưa ra hướng quản lý việc bảo tồn loài cây này.

    (Travis, S. E., J. Maschinski and P. Keim, 1996. An analysis of genetic variation in Astragalus cremnophylax a critically – endangered plant, using AFLP marker. Molecular Ecology 5:735-745)

      Van Droogenbroek B. et al., 2002. kỹ thuật này được ứng dụng để nghiên cứu mối quan hệ di truyền giữa các giống đu đủ trồng và đu đủ hoang dại (Caricaceae) ở Ecuador

    (Van Droogenbroek B., Breyne P., Goetghebeur P., Romeijin Peter E., Kyndt T., Gheysen G., 2002. AFLP analysis of genetic relationships among papaya and its wild relative (Caricaceae) from Ecuador. Theor Appl Genet 105: 289-297)

      Nguyễn Thị Loan Anh và cộng sự đã sử dụng kỹ thuật AFLP để nghiên cứu đa dạng sinh học các giống bưởi (Citrus maxima (Burm.) Merr.) ở Việt Nam. Kết quả tổng số có 60 dấu phân tử ghi nhận được, trong đó có 6 dấu phân tử xuất hiện ở tất cả các giống bưởi nghiên cứu, 2 dấu phân tử xuất hiện với tần suất 1/40 giống.

    (Nguyễn Thị Loan Anh, Đỗ Tấn Khang, Trần Nhân Dũng, Hà Thanh Toàn, Tina Kyndt, Godelieve Gheysen, Marcelle Holsters, 2008. Nghiên cứu đa dạng sinh học các giống bưởi ( Citrus maxima (Burm.) Merr.) ở Việt Nam. Hội nghị khoa học cây ăn trái quan trọng ở Đồng Bằng Sông Cửu Long. NXB Nông Nghiệp TPHCM).

    --- Bài cũ hơn ---

  • Tìm Hiểu Về Dịch Vụ Xét Nghiệm Xác Định Đột Biến Gen Bằng Kỹ Thuật Pcr
  • Tư Vấn Xét Nghiệm Hiv Bằng Phương Pháp Pcr
  • Tìm Hiểu Phương Pháp Xét Nghiệm Pcr Hiv Hiện Nay
  • Tại Sao Áp Dụng Gộp Mẫu Thực Hiện Xét Nghiệm Rt
  • Những Ai Cần Làm Xét Nghiệm Rt
  • Web hay
  • Links hay
  • Push
  • Chủ đề top 10
  • Chủ đề top 20
  • Chủ đề top 30
  • Chủ đề top 40
  • Chủ đề top 50
  • Chủ đề top 60
  • Chủ đề top 70
  • Chủ đề top 80
  • Chủ đề top 90
  • Chủ đề top 100
  • Bài viết top 10
  • Bài viết top 20
  • Bài viết top 30
  • Bài viết top 40
  • Bài viết top 50
  • Bài viết top 60
  • Bài viết top 70
  • Bài viết top 80
  • Bài viết top 90
  • Bài viết top 100